Overslaan en naar de inhoud gaan

IMIS

Publicaties | Datasets
[ meld een fout in dit record ] Print deze pagina

Bacteria in Antarctic glacial foreland soils
Citatie
Yan W, Ma H, Shi G, Sun B, Xiao X, Zhang Y (2018): Bacteria in Antarctic glacial foreland soils. v1.3. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils&v=1.3 https://doi.org/10.15468/6pzeer
Contact: Yan, Wenkai

Toegang tot data
Gearchiveerde data
Beschikbaarheid: Creative Commons License Deze dataset valt onder een Creative Commons Naamsvermelding 4.0 Internationaal-licentie.

Beschrijving
Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA) in an Antarctic glacial foreland soil gradient. meer

Surface soil layers, approximately 5 cm, were collected. When sites were covered by ice (3,4 and 5), the covering ice was gently cracked and the ice fractures were removed before sampling the soil beneath. The samples were stored in plastic bags and kept at -20°C during transport and storage in the laboratory until they were used for further analysis.

Study Extent: Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica (-69.39762S, 76.40666 E), during the 29th Chinese National Antarctic Research Expedition in the Antarctic summer in February 2013.

Method step description:

  1. Each soil sample was homogenized and sub-sampled for DNA extraction and geochemical measurements.
  2. An SDS-based method was employed to extract the DNA from soil (Natarajan et al., 2016). The bacterial V4 region of the 16S rRNA gene was amplified with a special bacterial primer pair 533F (TGCCAGCAGCCGCGGTAA)/Bact806R (GGACTACCAGGGTATCTAATCCTGTT). A sample tagging approach was employed, and a different barcode was added before the forward primer for each sample. The PCR reagents were mixed as follow: 5 μl of 10× Taq buffer (Takara, Otsu, Shiga, Japan), 4 μl of dNTP (Takara, Otsu, Shiga, Japan), 1 μl of each primer (10 μM stored concentration), 0.25 μl of Ex Taq DNA polymerase (Takara, Otsu, Shiga, Japan), approximately 50 ng of DNA, 2.5 μl of BSA (Bull Serum Albumin), and 32.75 μl of water. The PCR amplification consisted of an initial denaturation at 94°C for 5 min; 25 cycles of denaturation at 94°C for 40 s, annealing at 58°C for 40 s, and extension at 72°C for 1 min; and a final extension at 72°C for 8 min. The PCR products were purified with a Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, United States) according to the manufacturer’s instructions.
  3. The reads were obtained with MiSeq sequencing platform (Illumina, San Diego, CA, United States).

Scope
Kernwoorden:
Terrestrisch, Dna sequencing, Glacial soils, Metadata, Antarctica, Bacteria

Geografische spreiding
Antarctica [Marine Regions]

Spreiding in de tijd
Februari 2013

Taxonomic coverage
Bacteria [WoRMS]

Parameter
Moleculaire data

Bijdrage door
Shanghai Jiao Tong University (SJTU), meerdata creator
Polar Research Institute of China (PRIC), meerdata creator

Gerelateerde datasets
Gepubliceerd in:
AntOBIS: Antarctic Ocean Biodiversity Information System, meer
(Gedeeltelijk) opgenomen in:
RAS: Register of Antarctic Species, meer

Dataset status: Afgelopen
Data type: Meta database
Data oorsprong: Onderzoek: veldonderzoek
Metadatarecord aangemaakt: 2019-03-29
Informatie laatst gewijzigd: 2019-04-10
Alle informatie in het Integrated Marine Information System (IMIS) valt onder het VLIZ Privacy beleid