Overslaan en naar de inhoud gaan

IMIS

Publicaties | Datasets
[ meld een fout in dit record ] Print deze pagina

Aeolian microbial dispersal limitation to Antarctica (2017)
Citatie
Archer S, Maestre F, Maki T, Lee C, Cowan D, Pointing S (2021): Aeolian microbial dispersal limitation to Antarctica (2017). v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=aeolian_microbes_antarctica&v=1.0 https://doi.org/10.15468/ktwewp

Toegang tot data
Gearchiveerde data
Beschikbaarheid: Creative Commons License Deze dataset valt onder een Creative Commons Naamsvermelding 4.0 Internationaal-licentie.

Nota: The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Beschrijving
Amplicon sequencing dataset (Illumina MiSeq) targeting Bacteria (16S ssu rRNA) and Fungi (ITS) in samples (n=110) from soils and aerosol in the McMurdo Dry Valleys and New Zealand. meer

Sampling of air mass above the boundary layer for surface influence was achieved by mounting the apparatus in a helicopter with an external sampling port.
Air mass at near-surface (1.5m above ground) and underlying soil was sampled from 11 to 23 January 2017 at valley and elevated locations throughout the Wright Valley, McMurdo Dry Valleys, Antarctica. Comparison samples were taken from the North Island of New Zealand.
Total DNA was directly extracted using a CTAB protocol. DNA yield for these ultra-low biomass samples was quantified using the Qubit 2.0 Fluorometer (Invitrogen) in the range 1.06-8.44ng. Samples were then stored at -20 C. Illumina MiSeq libraries were prepared as per manufacturer’s protocol (Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B; Illumina, San Diego, CA, USA) and with PhiX positive controls. Bacteria and Fungi were targeted with domain-specific PCR primers PCR1 forward (5’ TCGTCGGCAGCGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG 3’) and PCR1 reverse (5’ GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGACTAC HVGGGTATCT AATCC 3’) and the internal transcribed spacer region of fungal 18S and 5.8S rRNA genes: ITS1 forward (5' CTTGGTCATTTAGAGGAAGTAA 3') and ITS2 reverse (5' GCTGCGTTCTTCATCGATGC 3').
Funding was provided by a grant from the New Zealand Ministry of Business, Innovation & Employment (UOWX1401) and the Yale-NUS College Start-Up Fund. Additional support was given by the European Research Council (BIODESERT project, ERC Grant agreement n° 647038).

Scope
Thema's:
Biologie > Ecologie - biodiversiteit
Kernwoorden:
Terrestrisch, Aërosolen, Air masses, Bodem, Dna sequencing, Metadata, Antarctica, Victoria Land, McMurdo Dry Valleys, New Zealand, Bacteria, Fungi

Geografische spreiding
Antarctica, Victoria Land, McMurdo Dry Valleys Stations [Marine Regions]
Bull Pass, Valley ridge
New Zealand Stations [Marine Regions]
Glen Eden, Auckland

Spreiding in de tijd
11 Januari 2017 - 23 Januari 2017

Taxonomic coverage
Bacteria [WoRMS]
Fungi [WoRMS]

Parameter
DNA

Bijdrage door
Auckland University of Technology, meerdata creator
University Rey Juan Carlos (URJC), meerdata creator
Kanazawa University, meerdata creator
University of Waikato, meerdata creator
University of Pretoria, meerdata creator

Gerelateerde datasets
Gepubliceerd in:
AntOBIS: Antarctic Ocean Biodiversity Information System, meer
(Gedeeltelijk) opgenomen in:
RAS: Register of Antarctic Species, meer

Dataset status: Afgelopen
Data type: Meta database
Data oorsprong: Onderzoek: veldonderzoek
Metadatarecord aangemaakt: 2021-07-05
Informatie laatst gewijzigd: 2021-07-05
Alle informatie in het Integrated Marine Information System (IMIS) valt onder het VLIZ Privacy beleid